View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20304_high_24 (Length: 242)

Name: NF20304_high_24
Description: NF20304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20304_high_24
NF20304_high_24
[»] chr7 (1 HSPs)
chr7 (18-229)||(45374040-45374251)


Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 45374040 - 45374251
Alignment:
18 agggttgaggttgcgattgttgcatagggaaatgaattagataaatatcctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagca 117  Q
    |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
45374040 agggttgaggttgccattgttgcatagggaaatgaattagataaataacctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagca 45374139  T
118 ttgctgcagctgctgatgttgtgtgtgctatggcagttgcagctggtgggagtgggtgattgtggttgccttcatatgttgttattagtattgtcttgtc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45374140 ttgctgcagctgctgatgttgtgtgtgctatggcagttgcagctggtgggagtgggtgattgtggttgccttcatatgttgttattagtattgtcttgtc 45374239  T
218 ttctgcacatct 229  Q
    ||||||||||||    
45374240 ttctgcacatct 45374251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University