View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20304_low_14 (Length: 330)
Name: NF20304_low_14
Description: NF20304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20304_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 114 - 322
Target Start/End: Complemental strand, 31645168 - 31644960
Alignment:
| Q |
114 |
ccacctgttcaccatatagcaaggttctgtataatgtaattattctcnnnnnnnnnnnnnnnnnaggaaataaatgtaaatattcttagttgcattgtgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31645168 |
ccacctgttcaccatatagcaaggttctgtataatgtaattattctctttttttatttttttttaggaaataaatgtaaatattcttagttgcattgtgt |
31645069 |
T |
 |
| Q |
214 |
gtatccaagtctcattcttggctctcaaaaagtagctatcaggagtaataaatacacacatagccatattttgaatcaaacaaaaacaatagaatatcgt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31645068 |
gtatccaagtctcattcttggctctcaaaaagtagctatcaggagtaataaatacacacatagccatattttgaatcaaacaaaaacaatagaatatcgt |
31644969 |
T |
 |
| Q |
314 |
atctctgct |
322 |
Q |
| |
|
|||| |||| |
|
|
| T |
31644968 |
atctttgct |
31644960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 114
Target Start/End: Complemental strand, 31645212 - 31645183
Alignment:
| Q |
85 |
acctcaaagtgaatgatgcctttctctatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31645212 |
acctcaaagtgaatgatgcctttctctatc |
31645183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University