View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20304_low_19 (Length: 297)
Name: NF20304_low_19
Description: NF20304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20304_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 11 - 282
Target Start/End: Original strand, 47286213 - 47286484
Alignment:
| Q |
11 |
cacagatcatgattgtagcttccatggagatttggttttcgtctaatggaagaagaacagatgatcctgaactaggatagttatgaggatcaccacctgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286213 |
cacagatcatgattgtagcttccatggagatttggttttcgtctaatggaagaagaacagatgatcctgaactaggatagttatgaggatcaccacctgg |
47286312 |
T |
 |
| Q |
111 |
aatctcaggaaattctttaacagcgacgttttgtttgtaatcaaataaaatggatcgtgtgtttgcgaaaatgaaaaggtttccattaggtagaagatga |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286313 |
aatctcaggaaattctttaacaacgacgttttgtttgtaatcaaataaaatggatcgtgtgtttgcgaaaatgaaaaggtttccattaggtagaagatga |
47286412 |
T |
 |
| Q |
211 |
acgaatggatataagttgttttcgcttggatcgttagtttcttggagaaaagatagatgaatggatgaagaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286413 |
acgaatggatataagttgttttcgcttggatcgttagtttcttggagaaaagatagatgaatggatgaagaa |
47286484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University