View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20304_low_21 (Length: 272)
Name: NF20304_low_21
Description: NF20304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20304_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 120 - 238
Target Start/End: Complemental strand, 28093211 - 28093093
Alignment:
| Q |
120 |
atgtcagtaaatcacacacaacagtgcataatttgattgacagattataaagaaatggtatagccagaaaatggtattatgcagtaaaatattaaccaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28093211 |
atgtcagtaaatcacacacaacagtgcataatttgattgacagattataaagaaatggtatagccagaaaatggtattatgcagtaaaatattaaccaga |
28093112 |
T |
 |
| Q |
220 |
aaatcggatttataggcag |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28093111 |
aaatcggatttataggcag |
28093093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 28093330 - 28093276
Alignment:
| Q |
1 |
aaaagtgtagcaaaacacaacggataaggtcgcacacaaaacacagattcccgca |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28093330 |
aaaagtgtagcaaaacacaacggataaggtcgcacacaaaacacagattcccgca |
28093276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 28093422 - 28093368
Alignment:
| Q |
1 |
aaaagtgtagcaaaacacaacggataaggtcgcacacaaaacacagattcccgca |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28093422 |
aaaagtgtagcaaaacacaacggataaggtcgcacacaaaacacagattcccgca |
28093368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University