View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20304_low_28 (Length: 228)
Name: NF20304_low_28
Description: NF20304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20304_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 70 - 214
Target Start/End: Original strand, 49082336 - 49082480
Alignment:
| Q |
70 |
tattattctccaccatgcctttaatgctttaattttttaaatgcagttgcggcagttcgtgatgggttaaaggcatgggaaacattaaagaataaatcac |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49082336 |
tattattctccaccatgcctttaatgctttaattttttaaatgcagttgcagctgttcgtgatgggttaaaggcatgggaaacattaaagaataaatcac |
49082435 |
T |
 |
| Q |
170 |
ttgacatagatctcgtattaacagaagtcgatctaccatcaatct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49082436 |
ttgacatagatctcgtattaacagaagtcgatctcccatcaatct |
49082480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University