View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20304_low_9 (Length: 385)
Name: NF20304_low_9
Description: NF20304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20304_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 13 - 254
Target Start/End: Complemental strand, 37202660 - 37202419
Alignment:
| Q |
13 |
atactgcaactcaattgtataggaaagtagaatcgggcttatttctcccgtctccggtcgcgaaacggagacaatactggctttgggcaattcctcgaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37202660 |
atactgcaactcaattgtataggaaagtagaatcgggcttatttctcccgtctccggtcgcgaaacggagacaatactggctttgggcaattcctcgaaa |
37202561 |
T |
 |
| Q |
113 |
atcctcaccggttctccgcattgccgggatgctgatactgaatcagacgattgaatcaacggctccgacgacatcggtcggaatcaacgatcaatttcag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37202560 |
atcctcaccggttctccgcattgccgggatgctgatactgaatcagacgattgaatcaacggctccgacgacataggtcggaatcaacgatcaatttcag |
37202461 |
T |
 |
| Q |
213 |
ataattctctacttgaacgcaaagtacacaacacgttactgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37202460 |
ataattctctacttgaacgcaaagtacacaacacgttactgt |
37202419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 283 - 371
Target Start/End: Complemental strand, 37202390 - 37202302
Alignment:
| Q |
283 |
attgacatgaaaggagtgtgttggtttttatagtttttagagtttcttacatcataacatttgttacaaagtaataaatatattaaatg |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37202390 |
attgacatgaaaggagtgtgttggtttttatagtttttagagtttcttacatcataacatttgttacaaagtaataaatatattaaatg |
37202302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University