View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20306_high_1 (Length: 287)
Name: NF20306_high_1
Description: NF20306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20306_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 12 - 277
Target Start/End: Complemental strand, 32169748 - 32169483
Alignment:
| Q |
12 |
aagaatatgaaatggaacaagtgtgaaaaggaataaaacaagaatgacatctggtgccacctaaatattgtctttgaccatagaaaatgaagcttacaaa |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169748 |
aagaaaatgaaatggaacaagtgtgaaaaggaataaaacaagaatgacatctggtgccacctaaatattgtctttgaccatagaaaatgaagcttacaaa |
32169649 |
T |
 |
| Q |
112 |
taataatagtttgccctccatcccacgtctctttcaaatgctaaccttttgcatgttataatgagaaaatttcatggttttcgagttggatcgacatggg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169648 |
taataatagtttgccctccatcccacgtctctttcaaatgctaaccttttgcacgttataatgagaaaatttcatggttttcgagttggatcgacatggg |
32169549 |
T |
 |
| Q |
212 |
aggttaaaatatactccacgttagattaagacgcctctttcattcaatagatcgatttttatttaa |
277 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32169548 |
aggttaaaatatacttcacgttagattaagacgcctctttcattcaataggtcgatttttatttaa |
32169483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University