View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20306_low_3 (Length: 222)
Name: NF20306_low_3
Description: NF20306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20306_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 53 - 205
Target Start/End: Complemental strand, 22557985 - 22557833
Alignment:
| Q |
53 |
aaatttccctttgttgagatgtagtaattgtacttgatttagatgtgttattagtactataataaagtaatttaagtttatgtatatgttttgatcatgt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22557985 |
aaatttccctttgttgagatgtagtaattgtacttgatgtagatgtgttattagtattataataaagtaatttaagtttatgtatatgttttgatcatgt |
22557886 |
T |
 |
| Q |
153 |
tataataaattatattattataaaatattaaatttcccttttaggccttgtgt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22557885 |
tataataaattatattattataaaatattaaatttcccttttaggccttgtgt |
22557833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University