View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20307_low_1 (Length: 240)
Name: NF20307_low_1
Description: NF20307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20307_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 65 - 210
Target Start/End: Original strand, 39336412 - 39336557
Alignment:
| Q |
65 |
tccattcaagatggaagaagcagggttggctgctatcattgagaagcagacctcaacggagaaaactagtggcaccatcaagacatgtcattttgaggta |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39336412 |
tccattcaagatggaagaagcagggttggctgctatcattgagaagcagacctcaacggagaaaactagtggcaccatcaagacatgttattttgaggta |
39336511 |
T |
|
| Q |
165 |
gcattgagtaaagtctctccgtctgtgtcgaaaatggtacggatct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39336512 |
gcattgagtaaagtctctccgtctgtgtcgaaaatggtacggatct |
39336557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 7295110 - 7295060
Alignment:
| Q |
153 |
cattttgaggtagcattgagtaaagtctctccgtctgtgtcgaaaatggta |
203 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||| |||||||| |
|
|
| T |
7295110 |
cattttgaggtagcactgactaaagtctctccgtctgtgtcagaaatggta |
7295060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University