View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20308_high_22 (Length: 324)
Name: NF20308_high_22
Description: NF20308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20308_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 41 - 306
Target Start/End: Original strand, 32258039 - 32258306
Alignment:
| Q |
41 |
ctagcaaaagggaaaaatatatatttccaattttataatacaaaaaccgttaaatacatttcagattataaaatctctaacgagtaaactagattaaaca |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32258039 |
ctagcaaaaaggaaaaatatatatttccaattttataatacaaaaaccgttaaatacatttcagattataaaatctctaacgagtaaaatagattaaaca |
32258138 |
T |
 |
| Q |
141 |
tacatactgagtccgctaggtagaatatagcaaagattattaagcaagcagtatagaattatccattgcttctataaagcattgtactttatgttttgct |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32258139 |
tacatactgaatccgctaggtagaatatagcaaagattattaagcaagcagtatagaattatccattgcttctataaagcattgtactttatgttttgct |
32258238 |
T |
 |
| Q |
241 |
ctgaacttataattc--agagagtttcatattcatatcagaatatctgcaagctgaaacaatttaact |
306 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32258239 |
ctgaacttataattcagagagagtttcatattcatatcagaatatctgcaagctgaaacaatttaact |
32258306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University