View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20308_low_24 (Length: 351)
Name: NF20308_low_24
Description: NF20308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20308_low_24 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 9 - 351
Target Start/End: Complemental strand, 36272699 - 36272357
Alignment:
| Q |
9 |
taattcttccaaagatggagaacaatgtaaatctctctctctatatatatagacacacataaattattttctcaaatcctttcttatttaatcatattta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272699 |
taattcttccaaagatggagaacaatgtaaatctctttctatatatatatagacacacataaattattttctcaaatcctttcttatttaatcatattta |
36272600 |
T |
|
| Q |
109 |
ataaatgtgnnnnnnnnnnnatttgcagttgatgcaactgaagaattcaaaacaaaaattgtggtagatatggatgaaggtttgaaaggagttagtcatg |
208 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272599 |
ataaatgtgtttttttttttatttgcagttggtgcaactgaagaattcaaaacaaaaattgtggtagatatggatgaaggtttgaaaggagttagtcatg |
36272500 |
T |
|
| Q |
209 |
gtgaagaccatggaggaggacacgtcgatggaggtttgggattttggggaaatttgggagggctaaaaggttggtttgaatggatggcaaacgaagcaat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272499 |
gtgaagaccatggaggaggacacgtcgatggaggtttgggattttggggaaatttgggagggctaaaaggttggtttgaatggatggcaaacgaagcaat |
36272400 |
T |
|
| Q |
309 |
ttcgggaataggagaaagccaaggagggtttggagtcagttgg |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272399 |
ttcgggaataggagaaagccaaggagggtttggagtcagttgg |
36272357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 129 - 183
Target Start/End: Original strand, 36260757 - 36260811
Alignment:
| Q |
129 |
atttgcagttgatgcaactgaagaattcaaaacaaaaattgtggtagatatggat |
183 |
Q |
| |
|
|||||||| || ||||||| |||||| |||||||||||||| ||||||||||||| |
|
|
| T |
36260757 |
atttgcagctggtgcaactaaagaatacaaaacaaaaattgaggtagatatggat |
36260811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University