View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20308_low_32 (Length: 282)
Name: NF20308_low_32
Description: NF20308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20308_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 65 - 266
Target Start/End: Complemental strand, 19384283 - 19384082
Alignment:
| Q |
65 |
catcccctctacctgtttaatgttgtaggatatacgttataaaccaaataaaagttaacgaggagctcacacagtgtctttctccaagttcaatcaacca |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19384283 |
catcccctctacctgtttaatgttgtaggatatacgttataaaccaaataaaagttaatgaggagctcacacagtgtctttctccaagttcaatcaacca |
19384184 |
T |
|
| Q |
165 |
aaacctccacaaagccataaccttcccatccactgtagctgatatattagtccagttcgtgtgagaaaactccactttgttcaacccttcaataagccca |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19384183 |
aaacctccacaaagccataaccttcccatccattgtagctgatatattagtccagttcgtgtgagaaaactccactttgttcaacccttcaataagccca |
19384084 |
T |
|
| Q |
265 |
ct |
266 |
Q |
| |
|
|| |
|
|
| T |
19384083 |
ct |
19384082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 19384377 - 19384312
Alignment:
| Q |
1 |
aaaaacaatggcatgagagtaaggaannnnnnnnatggaatttcatgcaaataaaaaggcattaca |
66 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19384377 |
aaaaacaatggcatgagagtaaggaattttttttatggaatttcatgcaaataaaaaggcattaca |
19384312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University