View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20308_low_34 (Length: 268)
Name: NF20308_low_34
Description: NF20308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20308_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 12365579 - 12365811
Alignment:
| Q |
17 |
actcaaattgatactacatgtataagttatgggaatcttccaccgcaattcaaatcagttaatcctcaagaaattcgggaaagctccaaacaagcatctc |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||| | ||| ||||||| |
|
|
| T |
12365579 |
actcaaattgatactacatgtataagtcatgggaatcttccaccgcaattcaaaccagtcaatcctcaagaaattggggaaagctctagacaggcatctc |
12365678 |
T |
 |
| Q |
117 |
aaccagaacaagactttcaggaaaatattgaacaacagttcacacaagtgaattttgaagaaaatccaatggatattgagccttccgagaatcttgatga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
12365679 |
aaccagaacaagactttcaggaaaatattgaacaacagttcacacaaatgaattttgaagaaaatccaacggatattgagcctttagagaatcttgatga |
12365778 |
T |
 |
| Q |
217 |
agagacaataaaggaactaataggggacagctg |
249 |
Q |
| |
|
|||||| |||||| ||||||||| ||||||||| |
|
|
| T |
12365779 |
agagaccataaagcaactaatagcggacagctg |
12365811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 193
Target Start/End: Original strand, 657492 - 657544
Alignment:
| Q |
141 |
atattgaacaacagttcacacaagtgaattttgaagaaaatccaatggatatt |
193 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||||||||||||||| ||||| |
|
|
| T |
657492 |
atattgaacaacaattcacgaaaatgaattttgaagaaaatccaatgaatatt |
657544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University