View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20308_low_36 (Length: 262)
Name: NF20308_low_36
Description: NF20308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20308_low_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 33177298 - 33177065
Alignment:
| Q |
16 |
atagctaaacatgaaattgttatgatgccaacactatctcttaacg-ttttagtacacaagttattgttaagtgaaaatcatacgggtctcaacacttta |
114 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33177298 |
atagctaaacattaaattgttatgatgccaaaactatctcttaacgcttttagtacacaagttattgttaagtgaaaatcatacgggtctcaacacttta |
33177199 |
T |
|
| Q |
115 |
tgtgggacatgtttacagggtcatgctaaccctgtaaatttcatcaaattagagagtacatgttgaaaataaattattacattgggtatgttgctagccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33177198 |
tgtgggacatgtttacagggtcatgctaaccccgtaaatttcatcaaattagagagtacatgttgaaaataaattattacattggggatgttgctagccc |
33177099 |
T |
|
| Q |
215 |
tcatcaacatgaaatttatgatgtgaacgttgat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33177098 |
tcatcaacatgaaatttatgatgtgaacgttgat |
33177065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University