View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20308_low_40 (Length: 247)
Name: NF20308_low_40
Description: NF20308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20308_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 3122076 - 3121845
Alignment:
| Q |
1 |
catcccagcaattgtcataattaaacgataatagaaagataattgtagcaataaacacctaattagaactaaaaag-atgtagcaaagtactaataaata |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
3122076 |
catcccagcaattgtcataattaaacgataatagaaagataattgtagcaataaacacctaattagaactaaaatggatgtagcaaagtactgataaata |
3121977 |
T |
 |
| Q |
100 |
taacaatatcaaagcatggatcaaccaacccttcatttgctactgcaatttggctaaggacttgccctcacaaatgtaccaaacataaccaaatggatcc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3121976 |
taacaatatcaaagcatggatcaaccaacccttcatttgctactgcaatttggctaaggacttgccctcacaaatgtaccaaacataaccaaatggatcc |
3121877 |
T |
 |
| Q |
200 |
ctcagcttcacaatgtgctgaccagcataagt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3121876 |
ctcagcttcacaatgtgctgaccagcataagt |
3121845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University