View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20308_low_41 (Length: 246)
Name: NF20308_low_41
Description: NF20308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20308_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 3942456 - 3942227
Alignment:
| Q |
1 |
aacatatttatttgacgaacgtaattttaaactcaagtccagttcattgtcagtcttgagggattgttaatatagaaccactagnnnnnnnnnnnnagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3942456 |
aacatatttatttgacgaacgtaattttaaactcaagtccagttcattgtcagtcttgagggattgttaatatagaaccactagtttttttttttt-gaa |
3942358 |
T |
 |
| Q |
101 |
tgagttttatagcaaagctgtggatttgagtatttttagtcattatttatttataattggttaatgcactccttctaactacatattctaaaataggcgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
3942357 |
tgagttttatagcaaagctgtggatttgagtatttttagccattatttatttataattggttaatgcactccttctaactacaaattctaaaataggtgg |
3942258 |
T |
 |
| Q |
201 |
ggtgcacattagcagttggtagtagacattt |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
3942257 |
ggtgcacattagcagttggtagtagaaattt |
3942227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University