View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20308_low_45 (Length: 220)
Name: NF20308_low_45
Description: NF20308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20308_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 7804337 - 7804531
Alignment:
| Q |
11 |
aagaacgaatctgccccatcctatgacaaacctgagaagcattgttgcagaaaccgaacagatgaaggttgtcttctaaatcattggcacaaagaacatg |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7804337 |
aagaacgaatctgccccaccctatgacaaacctgagaagcattgttgcagaaaccgaacagatgaaggttgtcttctaaatcattggcacaaagaacatg |
7804436 |
T |
 |
| Q |
111 |
atggcttagacaattaacacccgtttaaagttccataataagatgtcgtggcttgatcctacacatcacttgtaaccttcacgaacggcaaacct |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7804437 |
atggcttagacaattaacacccgtttacagttccataataagatgtcgtggcttgatcctacgcatcacttgtaaccttcacgaacggcaaacct |
7804531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University