View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20309_high_4 (Length: 249)
Name: NF20309_high_4
Description: NF20309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20309_high_4 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 113 - 249
Target Start/End: Complemental strand, 783566 - 783430
Alignment:
| Q |
113 |
tttagcatttgtcacataaataaatgtgataatataagtacatgcattacatacccaattaagcaagcattatgaatccttacacatcaaaaggttgctt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
783566 |
tttagcatttgtcacataaataaatgtgataatataagtacatgcattacatacccaattaagcaagcattatcaatccttacacatcaaaaggttgctt |
783467 |
T |
|
| Q |
213 |
accagtaaatttaacctcaattgggctaacattcttc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783466 |
accagtaaatttaacctcaattgggctaacattcttc |
783430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 53
Target Start/End: Complemental strand, 783656 - 783620
Alignment:
| Q |
17 |
attactaataaaagctaaagcggattaatattcattc |
53 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
783656 |
attactaataaaagctaaagcagattaatattcattc |
783620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University