View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2030_high_39 (Length: 233)
Name: NF2030_high_39
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2030_high_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 37171029 - 37170812
Alignment:
| Q |
1 |
cgcaaacggagtacgcccgtaaacgagttcatagatgaatatcccaaacgaccaccaatccacggcgttgccgtgggagtttccggcggcaacttccggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37171029 |
cgcaaacggagtacgcccgtaaacgagttcatagatgaatatcccaaacgaccaccaatccacggcgttgccgtgggagtttccggcggcaacttccggc |
37170930 |
T |
|
| Q |
101 |
gagacatattcatgtgttccaacaaatgaacaagagcgagcagacaccggttcagctacaaaaagccggttcggttgaacagtttgaaccttacgggatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37170929 |
gagacatattcatgtgttccaacaaatgaacaagaccgagcagacaccggttcagctacaaaaagccggttcggttgaacagtttgaaccttacgtgatt |
37170830 |
T |
|
| Q |
201 |
taaacaaccggttagaaa |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37170829 |
taaacaaccggttagaaa |
37170812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 32 - 192
Target Start/End: Original strand, 6072648 - 6072808
Alignment:
| Q |
32 |
tagatgaatatcccaaacgaccaccaatccacggcgttgccgtgggagtttccggcggcaacttccggcgagacatattcatgtgttccaacaaatgaac |
131 |
Q |
| |
|
||||||||||| ||||||||||||||||| || ||||| || || |||||||| | || |||||||| || ||||| || |||||||| || ||||||| |
|
|
| T |
6072648 |
tagatgaatattccaaacgaccaccaatcaacagcgttaccatgtgagtttcctgaagctacttccggtgaaacatactcgtgtgttcccacgaatgaac |
6072747 |
T |
|
| Q |
132 |
aagagcgagcagacaccggttcagctacaaaaagccggttcggttgaacagtttgaacctt |
192 |
Q |
| |
|
|||| || || |||||||||||||||||||||||||| | ||||| | ||||||||| |
|
|
| T |
6072748 |
aagaccgtgcttcaaccggttcagctacaaaaagccggtttgattgaaatgattgaacctt |
6072808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University