View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2030_high_44 (Length: 222)
Name: NF2030_high_44
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2030_high_44 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 222
Target Start/End: Original strand, 32101467 - 32101687
Alignment:
| Q |
6 |
atttttcaacacaaaaacaatatgcacattgtagggtattttgtctatgtaaaaatgtatatgatataatagatgttcatatttgtggatatatattcct |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32101467 |
atttttcaacacaaaaacaatatgcacattgtaggctattttgtctatgtaaaaatgtatatgatataatagatgttcatatttgtggatatatattcct |
32101566 |
T |
|
| Q |
106 |
aaaatgttgctgacggttcataaattcgtaggtgat----gatatagcatttaagcaacactcgcgggggcctctgcaacaatctgcatgcctcaccaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32101567 |
aaaatgttgctgacggttcataaattcgtaggtgatgatcgatatagcatttaagcaacactcgcgggggcctctgcaacagtctgcatgcctcaccaaa |
32101666 |
T |
|
| Q |
202 |
atgcatatctaaccgggggaa |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32101667 |
atgcatatctaaccgggggaa |
32101687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University