View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2030_high_45 (Length: 205)

Name: NF2030_high_45
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2030_high_45
NF2030_high_45
[»] chr3 (1 HSPs)
chr3 (1-186)||(936642-936827)


Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 936827 - 936642
Alignment:
1 taccaatcttgcatcttcatctctaagttctctttgtgacatggttaacccttcagaatcaccaccaccttttgaaccatacctcacagtactttttgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
936827 taccaatcttgcatcttcatctctaagttctctttgtgacatggttaacccttcagaatcaccaccaccttttgaaccatacctcacagtactttttgat 936728  T
101 cctgaatggtttaaactactcatttccctcacagaattgttcctcttgctagaacccatagaatgaatggacatggaacttttgct 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
936727 cctgaatggtttaaactactcatttccctcacagaattgttcctcttgctagaacccatagaatgaatggacatggaacttttgct 936642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University