View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2030_low_20 (Length: 345)
Name: NF2030_low_20
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2030_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 9e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 210 - 323
Target Start/End: Original strand, 7500243 - 7500356
Alignment:
| Q |
210 |
gcggttggagtagctatgaaggaaggagagttctgaagatgcgtaggaatgtgtgatttgtgtcttaactttcaagggggttccctacttatatgttgtg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500243 |
gcggttggagtagctatgaaggaaggagagttctgaagatgcgtaggaatgtgtgatttgtgtcttaactttcaagggggttccctacttatatgttgtg |
7500342 |
T |
 |
| Q |
310 |
tattaaaataataa |
323 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7500343 |
tattaaaataataa |
7500356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 210 - 323
Target Start/End: Original strand, 15171463 - 15171576
Alignment:
| Q |
210 |
gcggttggagtagctatgaaggaaggagagttctgaagatgcgtaggaatgtgtgatttgtgtcttaactttcaagggggttccctacttatatgttgtg |
309 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
15171463 |
gcggttggagtagctttgatggaagaagagttctgaagatgcgtaggagtgtgtgatttgtgtcttaactttcaagagggttcactacttatatgttgtg |
15171562 |
T |
 |
| Q |
310 |
tattaaaataataa |
323 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15171563 |
tattaaaataataa |
15171576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University