View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2030_low_22 (Length: 336)
Name: NF2030_low_22
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2030_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 7 - 330
Target Start/End: Complemental strand, 38829885 - 38829562
Alignment:
| Q |
7 |
tccccataattcctcatgtcgtttgcaaccgtcattactcgaccaaaataatcaatgatcgattcaccctgcttcattgctaagacctcaaagtctcggc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829885 |
tccccataattcctcatgtcgtttgcaaccgtcattactcgaccaaaataatcagtgattgattcaccctgcttcattgctaagacctcaaagtctcggc |
38829786 |
T |
|
| Q |
107 |
gtagacgattgagctgtgctctcttcactcgagcattgccgcgacacttcaacttcatggaatcccatagctgtttagatgtctccttctgcgtgatggt |
206 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | || |
|
|
| T |
38829785 |
gtagatgattgagttgtgctctcttcactcgagcattgtcgcgacacttcaacttcatggaatcccatagccgtttagatgtctccttctgcgtgttcgt |
38829686 |
T |
|
| Q |
207 |
cttcagaattgacttgtcaattgactgaaacaagtaattcttagccttcaaatccttcagcttcatctcatccagattctttatttgcactgcggtcatc |
306 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38829685 |
cttcagaattgacttgtcaattaactgaaacaagtaattcttagccttcaaatccttcagcttcatgtcatccagattctttatttgcactgcggtcatc |
38829586 |
T |
|
| Q |
307 |
ccatctctacttgttggctctgtg |
330 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
38829585 |
ccatctctacttgttggcactgtg |
38829562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University