View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2030_low_23 (Length: 314)
Name: NF2030_low_23
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2030_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 147 - 292
Target Start/End: Complemental strand, 29816707 - 29816562
Alignment:
| Q |
147 |
aattgggatatgagttgtgtgctctcacaatcccgtagccacatatatgtcgttggattaaaattggacggttcatatgcggctgagtacgtgcgatcac |
246 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||| || |||||||| |||||||| |||||| | ||||| |||| |
|
|
| T |
29816707 |
aattgggatatgagttgtgtgctgtcacaatcccgtagccacgtctatgtcgttggatcaagattggacgattcatatggggctgactgcgtgcagtcac |
29816608 |
T |
|
| Q |
247 |
actgtacacggttgagatgcaaacaattttccatgatttcaaaatc |
292 |
Q |
| |
|
||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
29816607 |
actgtacacggttgaaatcccaacaattttccatgatttcaaaatc |
29816562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 23 - 77
Target Start/End: Complemental strand, 29818226 - 29818172
Alignment:
| Q |
23 |
ttttagtgtcagctcctccacaaaaggcttctctggctctgatgttgctggttga |
77 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29818226 |
tttttgtgtcagctcctccacaaaaggcttctctggctctgatgttgctggttga |
29818172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University