View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2030_low_31 (Length: 292)
Name: NF2030_low_31
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2030_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 46303466 - 46303746
Alignment:
| Q |
1 |
ttttgtatttgttaatctctaatgnnnnnnncatattaatgaaggaatttgtcaagcttgaaccttggtggtgagatatcaccagcaattggtgatttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46303466 |
ttttgtatttgttaatctctaatgtttttttcatattaatgaaggaatttgtcaagcttgaaccttggtggtgagatatcaccagcaattggtgatttaa |
46303565 |
T |
 |
| Q |
101 |
gaaacttgcaatccatgtatgtcacctcttacttaacattctatgcatctctcataatttagattgaagtcgtgttcactgctcgaaataacactgaccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46303566 |
gaaacttgcaatccatgtatgtcacctcttacttaacattctatgcatctctcatactttagattgaagtcgtgttcactgcttgaaataacactgaccc |
46303665 |
T |
 |
| Q |
201 |
atgtcgttacatttaattgaatactttcatattctaaaaatttacttgtgtcgatgtgttagtgtctcgtttgtgcctttg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46303666 |
atgtcgttacatttaattgaatactttcatattctaaaaatttacttgtgtcgatgtgttagtgtctcgtttgtgtctttg |
46303746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University