View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2030_low_32 (Length: 282)
Name: NF2030_low_32
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2030_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 11 - 171
Target Start/End: Complemental strand, 8764664 - 8764507
Alignment:
| Q |
11 |
cacagactagagacgaactcgataaatattattacacttcccacaagtttcttgatttaattaatttctctatttctaacaattttacacataatttttt |
110 |
Q |
| |
|
||||||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
8764664 |
cacagactataggcgagctcgataaatattattacacttcccacaagtttcttgatttaattaatttctct---tctaacaattttacagataatttttt |
8764568 |
T |
 |
| Q |
111 |
ctcctttgctatagcctgagatttgttataaactatcaaaagctcttatttttgcttacca |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8764567 |
ctcctttgctatagcctgagatttgttataaactatcaaaagctcttacttttgcttacca |
8764507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 229 - 267
Target Start/End: Complemental strand, 8764449 - 8764411
Alignment:
| Q |
229 |
agtagtcaagaaccgtgcttaataacactcaatcttttg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8764449 |
agtagtcaagaaccgtgcttaataacactcaatcttttg |
8764411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University