View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2030_low_39 (Length: 244)
Name: NF2030_low_39
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2030_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 11619118 - 11619323
Alignment:
| Q |
16 |
aatatggtgactcagggcttgaagttctgggagaggttccctctaacaagattatttccattaggagatcttgcgattttcgtcattagattgttccatg |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11619118 |
aatacggtgactcagggcttgaagttctgggagaggttccctctaacaagattatttccattaggagatcttgcgattttcgtcattagattgtttcatg |
11619217 |
T |
 |
| Q |
116 |
gaatgcaatgatatgatgcaaatgatgatttatttctgaatccagggaaaacctaggccgggtttgtttcaaatttgnnnnnnnngcgtctgtaaacaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11619218 |
gaatgcaatgatatgatgcaaatgatgatttatttctgaatccagggaaaacctaggccgggtttgtttcaaatttg--ttttttgcgtctgtaaacaaa |
11619315 |
T |
 |
| Q |
216 |
atgacaaa |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
11619316 |
atgacaaa |
11619323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University