View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2030_low_49 (Length: 222)
Name: NF2030_low_49
Description: NF2030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2030_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 37 - 203
Target Start/End: Original strand, 2141049 - 2141215
Alignment:
| Q |
37 |
gttgggtgcaattatatttatatttgtatatgaagtaaatatactcatttctttagttggtgaataccttctaactttcttttacaatgcatgtgtatta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2141049 |
gttgggtgcaattatatttatatttgtatatgaagtaaatatactcatttctttagttggtgaataccttctaactttcttttacaatgcatgtgtatta |
2141148 |
T |
 |
| Q |
137 |
tttttggttgatcaatgtagatacatgatctttttatactgatgttcgtataattgttgacctcttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2141149 |
tttttggttgatcaatgtagatacatgatctttttatactgatgtttgtataattgttgacctcttg |
2141215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University