View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_high_21 (Length: 307)
Name: NF20312_high_21
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 20 - 297
Target Start/End: Complemental strand, 1807641 - 1807364
Alignment:
| Q |
20 |
ccaccttcattgccaaggaagacattatcagtcgtctatcgatcaacagcggattcaccgtccaccggaagttctcctcttgaaccatcagcagcttctc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807641 |
ccaccttcattgccaaggaagacattatcagtcgtctatcgatcaacggcggattcaccgtccaccggaagttctcctcttgaaccatcagcagcttctc |
1807542 |
T |
 |
| Q |
120 |
cttcaccatctgatcatccacaacaaccagctgatgaccaacaaagtgtgttaccatttatacatggcattcagattttcttggcaatctatttaagtat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807541 |
cttcaccatctgatcatccacaacaaccagctgatgaccaacaaagtgtgttaccatttatacatggcattcagattttcttggcaatctatttaagtat |
1807442 |
T |
 |
| Q |
220 |
tttatgtttgttgataattgtggtaatggtctttctcttgtttctatttgtaaaatatattcgaagccgctgcctttg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807441 |
tttatgtttgttgataattgtggtaatggtctttctcttgtttctatttgtaaaatatattcgaagccgctgcctttg |
1807364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University