View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_high_33 (Length: 246)
Name: NF20312_high_33
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 44198598 - 44198480
Alignment:
| Q |
8 |
cgaagaatatcgaaccacacttaattgtaagtgtcactggataggggggtgttcgtggctcataattgaattgtaactgcatcgtattaaccgtttggtt |
107 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44198598 |
cgaaaaatatccaaccacacttaattgtaagtgtcactagatagaggggtgttcgtggctcataattgaactgtaactgcatcgtattaaccgtttggtt |
44198499 |
T |
 |
| Q |
108 |
cagtttttaaaaatcattt |
126 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
44198498 |
cagtttttaaaaaccattt |
44198480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University