View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_high_37 (Length: 225)
Name: NF20312_high_37
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_high_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 328045 - 328243
Alignment:
| Q |
17 |
atattgcacctgaaactacagtttaaaactttgaatgatcactatttaattttgtctctattgttgtaatatcatattttgttttgaactggtatttagg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
328045 |
atattgcacctgaaactacagtttaaaactttgaatgatcactatttaattttgtctctattgttgtaatatcatattttgttttgaactggtatt-agg |
328143 |
T |
|
| Q |
117 |
caaactgtcaaaagcagcagtactcaaggcaatctgtgcaagtttccaagagaccactgagccatctatttgtttaactccaggtctttattcttctctc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
328144 |
caaactgtcaaaagcagcagtactcaaggcaatctgtgcaagtttccaagagaccactgagccatctatttgtttaactccaggtctttattcttttctc |
328243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 122 - 204
Target Start/End: Complemental strand, 27412630 - 27412548
Alignment:
| Q |
122 |
tgtcaaaagcagcagtactcaaggcaatctgtgcaagtttccaagagaccactgagccatctatttgtttaactccaggtctt |
204 |
Q |
| |
|
|||||| | |||| || ||||||||||| |||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
27412630 |
tgtcaagaccagcggttctcaaggcaatgtgtgcaggtttccaagagaccactgaaccatcaatttgcttaactccaggtctt |
27412548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University