View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_high_40 (Length: 206)
Name: NF20312_high_40
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 16 - 181
Target Start/End: Original strand, 18787787 - 18787952
Alignment:
| Q |
16 |
agaaggaagtgtttcaaaatttcgccctaactcgactagttttggtggaagaagcttttcacgaattgcacctcccgaatcaattcacaaaggagctggt |
115 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18787787 |
agaaggaaatgtttcaaaatttcaccctaactcgactagttttggtggaagaagcttttcacgaaatgcacctcccgaatcaattcacaaaggagctggt |
18787886 |
T |
|
| Q |
116 |
gttggatggggttcaggtagagggaaatcagaaaggactgatcacgagacgatcaacgaaaagatg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
18787887 |
gttggatggggttcaggtagagggaaatcagaaaggattgatcacgagacgatcaacgaaaggatg |
18787952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University