View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_low_27 (Length: 306)
Name: NF20312_low_27
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 7175177 - 7175459
Alignment:
| Q |
1 |
caacaagatcgaatggaagagtgggattcgagcgccgactcttagtgacggttgttctcgatgtcatttgtgagcgtggcggcgcaggc-----acatgg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
7175177 |
caacaagatcgaatggaagagtgggattcgagcgccgactctttgtgacggttgttctcgataccatttgtgagcgtggcggcgcaggcctggcacatgg |
7175276 |
T |
 |
| Q |
96 |
atgaatcaacgaatgaaatccaagtttatgaatcacagactgtttttggcgagttcgcctttgtttaattcttcttcatcaccgccgcttgcatcttcta |
195 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7175277 |
atgaatcaacgaatgaaatcgaagtttatgaatcacaga-----------gagttcgcctttgtttaattctacttcatcaccgccgcttgcatcttcta |
7175365 |
T |
 |
| Q |
196 |
ttgatttgaaaaataagtgtgctgtgagtgacctcgataaatagagactaatgaaatcaaaaaactactttaccttctccctctcactttattt |
289 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175366 |
ttgatttgaaaaataagtgtgctgtgattgacctcgataaatagagacgaatgaaatcaaaaaactactttaccttctccctctcactttattt |
7175459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University