View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_low_28 (Length: 292)
Name: NF20312_low_28
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 273
Target Start/End: Complemental strand, 6015193 - 6014933
Alignment:
| Q |
15 |
actaaccattccgaggctaaatgctacttatttatagggccaaagttggnnnnnnnnncatttaatttgttgtattaattctaactcatttggttagtta |
114 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6015193 |
actaaccattcccaaactaaatgctacctatttatagggccaaagttgaaaaaaaaaacatttaatttgttgtattaattctaactcatttagttagtta |
6015094 |
T |
 |
| Q |
115 |
tagtaatatggacgtgaacatgaatcacacgaaactgtggaccttcaaatcgaagggaaatgatccacgacaaaccaagtcaaggtcgaagtcacgtgtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6015093 |
tagtaatatggacgtgaacatgaatcacacgaaattgtggaccttcaaatcgaagggaaatgatccacgacaaaccaagtcaaggtcgaagtcacgtgtg |
6014994 |
T |
 |
| Q |
215 |
ggaatgtgtgatcacgttactgtatgtttatcgcactcc--atctgttatttatagcaaga |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
6014993 |
ggaatgtgtgatcacgttactgtatgtttatagcactccatatctattatttatagcaaga |
6014933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University