View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_low_35 (Length: 254)
Name: NF20312_low_35
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_low_35 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 15 - 254
Target Start/End: Original strand, 55355292 - 55355531
Alignment:
| Q |
15 |
agagaatggaagggaagagaagcttgcgtatgtgctgtttatgcaatgaaagaagagcttctctgaagagacctaaaacccttcaacagatttgcagaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55355292 |
agagaatggaagggaagagaagcttgcgtatgtgctgtttatgcaatgaaagaagagcttctctgaagagacctaaaacccttcaacagatttgcagaga |
55355391 |
T |
|
| Q |
115 |
atgcttctaccttgctttcgaagatgagattcatcaactcatcgtcgataactgcctcttcacccgcggcgaccgagtcgccatcggagcttccggcggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55355392 |
atgcttctaccttgctttcgaagatgagattcatcaactcatcgtcgataaccgcctcttcacccgcggcgaccgaatcgccatcggagcttccggcggt |
55355491 |
T |
|
| Q |
215 |
aaagactccaccgtcctcgcttacgtcttatccaaactca |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55355492 |
aaagactccaccgtcctcgcttacgtcttatccaaactca |
55355531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 32398975 - 32399051
Alignment:
| Q |
15 |
agagaatggaagggaagagaagcttgcgtatgtgctgtttatgcaatgaaagaagagcttctctgaagagacctaaa |
91 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32398975 |
agagaatggaagggaagagaagcgtgcgtatgtgctgtttatgcaatgaaagaagagcttctctcaagagacctaaa |
32399051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University