View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_low_37 (Length: 248)
Name: NF20312_low_37
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 36440936 - 36440717
Alignment:
| Q |
11 |
ttatactcaaaagtcattcaccatcagattttagacccgacacaataaaaagaaggccacgtaaatgacttatatgtcaccttgcccaaaaaacttataa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36440936 |
ttatactcaaaagtcattcaccatcagattttagacccgacacaataaaaagaaggccacgtaaatggcttatatgtcaccttgcccaaaaaacttataa |
36440837 |
T |
 |
| Q |
111 |
atcgcctgttttgatgaacgaatgatgagtaaatgtgctaggttttgatctgttgtataaaaatatatgttggtattatgttttcctaaatcttcttttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36440836 |
atcgcctgttttgatgaacgaatgatgagtaaatgtgctaggttttgatctgttgtataaaaatatatgttggtattatgttttcctaaatcttcttttg |
36440737 |
T |
 |
| Q |
211 |
agggatgttttcgaaattct |
230 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36440736 |
agggatgttttcgaaattct |
36440717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University