View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_low_40 (Length: 237)
Name: NF20312_low_40
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_low_40 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 151072 - 150863
Alignment:
| Q |
14 |
ttcttttttcaaaaagaataataatttgtatgtttatatgtaataatcagaaaccttataagctgaatcaaatcaacagaaaatgaagaaacaacgaaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
151072 |
ttcttttttcaaaaagaataataatttgtatgtttatatgtaataatcagaaaccttataagctgaatcaaatcaacagaaaatgaagaaacaacgaaaa |
150973 |
T |
 |
| Q |
114 |
attaaagatgctaagaaacgaacctgatgacaagttttgccattagcagaatcatagattcgatttccaataacacgaactccgcatttattgttccgat |
213 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150972 |
atcaaagaagctaagaaacgaacctgatgacaagttttgccattagcagaatcatagattcgatttccaataacacgaactccgcatttattgttccgat |
150873 |
T |
 |
| Q |
214 |
tcaatttctt |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
150872 |
tcaatttctt |
150863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 6917040 - 6917105
Alignment:
| Q |
133 |
gaacctgatgacaagttttgccattagcagaatcatagattcgatttccaataacacgaactccgc |
198 |
Q |
| |
|
||||||| ||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917040 |
gaacctggtgacaagattttccattttcagaatcatagattcgatttccaataacacgaactccgc |
6917105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University