View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20312_low_45 (Length: 214)
Name: NF20312_low_45
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20312_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 12 - 198
Target Start/End: Original strand, 17818614 - 17818800
Alignment:
| Q |
12 |
acttttaggtaagagggtggggtcaaaagtagatgtgacaaaacaatccataactattgatacatattggtaaataaaaattgaatttggatagcttaac |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17818614 |
acttttaggtaagagggtggggttaaaagtagatgtgacaaaataatccataactattgatacatatgggtaaataaaaattgaatttggatagcttaac |
17818713 |
T |
 |
| Q |
112 |
aatatcctaagataaattaatggattttaaaggtatggaaaggataacatgttacatgtgatatatgtctgtaatgctggtgatgtt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17818714 |
aatatcctaagataaattaatggattttaaaggtatggaaaggataacatgttacatgtgatatatgtctgtaatgctggtgatgtt |
17818800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University