View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20312_low_46 (Length: 206)

Name: NF20312_low_46
Description: NF20312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20312_low_46
NF20312_low_46
[»] chr4 (1 HSPs)
chr4 (16-181)||(18787787-18787952)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 16 - 181
Target Start/End: Original strand, 18787787 - 18787952
Alignment:
16 agaaggaagtgtttcaaaatttcgccctaactcgactagttttggtggaagaagcttttcacgaattgcacctcccgaatcaattcacaaaggagctggt 115  Q
    |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
18787787 agaaggaaatgtttcaaaatttcaccctaactcgactagttttggtggaagaagcttttcacgaaatgcacctcccgaatcaattcacaaaggagctggt 18787886  T
116 gttggatggggttcaggtagagggaaatcagaaaggactgatcacgagacgatcaacgaaaagatg 181  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||    
18787887 gttggatggggttcaggtagagggaaatcagaaaggattgatcacgagacgatcaacgaaaggatg 18787952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University