View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20313_low_20 (Length: 244)
Name: NF20313_low_20
Description: NF20313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20313_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 232
Target Start/End: Complemental strand, 28471057 - 28470838
Alignment:
| Q |
13 |
aatatggtacaagagggtgaacatcctaggactttaccttaccatgtccatttaattatcatatgattggtttcttcttaatttcttaccnnnnnnnctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28471057 |
aatatggtacaagagggtgaacatcctaggactttaccttaccatgtccatttaattatcatatgattggtttcttcttaatttcttacctttttttctt |
28470958 |
T |
|
| Q |
113 |
gtgagaactaaaacaaaatagattgtactgtttcatcagtaagggaacaaagctgaaaatatttatctgagaatatacatagaaactatgtggggtaata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28470957 |
gtgagaactaaaacaaaatagattgtactgtttcatcagtaagggaacaaagctgaaaatatttatctgagaatatacatagaaactatgtggggtaata |
28470858 |
T |
|
| Q |
213 |
tatatgatttgatttgatat |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
28470857 |
tatatgatttgatttgatat |
28470838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University