View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20313_low_22 (Length: 228)
Name: NF20313_low_22
Description: NF20313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20313_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 30 - 210
Target Start/End: Original strand, 43027413 - 43027593
Alignment:
| Q |
30 |
aatgaaggacatctcactttggtgccccacctatcttcgatacggatgttgaacttccctaaccctacaaaaaccaatgttacccaacaaccgtgtttta |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
43027413 |
aatgaaggacatctcactttggtgccccacctatcttcgatacggatgttgaacttccctaaccctacaaaaatcaatgttacccaagaaccaagtttta |
43027512 |
T |
 |
| Q |
130 |
tgttgtaaaagtcgcgtagagcacgccagcctttggtaaagaagatgccatagttgtttctctgaaccaaaatctcaaact |
210 |
Q |
| |
|
||||||||||| ||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43027513 |
tgttgtaaaagccgcgtagagcatgccggcctttggtaaagaagatgccacagttgtttctctgaaccaaaatctcaaact |
43027593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 68 - 115
Target Start/End: Original strand, 41395285 - 41395332
Alignment:
| Q |
68 |
gatacggatgttgaacttccctaaccctacaaaaaccaatgttaccca |
115 |
Q |
| |
|
||||| ||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
41395285 |
gatactgattttgaacttcactaaccctacaaagaccaatgttaccca |
41395332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University