View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20313_low_23 (Length: 218)
Name: NF20313_low_23
Description: NF20313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20313_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 46 - 194
Target Start/End: Complemental strand, 43239859 - 43239713
Alignment:
| Q |
46 |
ttgcctcgcacattattcgttatggtttcgctgtaaaagaattggcttgatatagcgccttcctcnnnnnnnnnnnnnnnnngaataatgatatatgtcc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
43239859 |
ttgcctcgcacattattcgttatggtttcgctttaaaagaattggcttgatatagcgccttcct--ttttctttctttttttgaataatgatatatgttc |
43239762 |
T |
|
| Q |
146 |
cgaagttttttatcccgaccaattcaaacccgtataaaataacatgatc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239761 |
cgaagttttttatcccgaccaattcaaacccgtataaaataacatgatc |
43239713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 43246585 - 43246527
Alignment:
| Q |
49 |
cctcgcacattattcgttatggtttcgctgtaaaagaattggcttgatatagcgccttc |
107 |
Q |
| |
|
|||| ||||||||||| ||||||||| ||||||||||| || |||||||||| ||||| |
|
|
| T |
43246585 |
cctcacacattattcgctatggtttcattgtaaaagaatcgggttgatatagcaccttc |
43246527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 43253050 - 43252992
Alignment:
| Q |
49 |
cctcgcacattattcgttatggtttcgctgtaaaagaattggcttgatatagcgccttc |
107 |
Q |
| |
|
|||| ||||||||||| ||||||||| ||||||||||| || |||||||||| ||||| |
|
|
| T |
43253050 |
cctcacacattattcgctatggtttcattgtaaaagaatcgggttgatatagcaccttc |
43252992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University