View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20314_high_12 (Length: 415)
Name: NF20314_high_12
Description: NF20314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20314_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 2e-71; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 245 - 410
Target Start/End: Original strand, 2347905 - 2348070
Alignment:
| Q |
245 |
cttgttatctttttcgcgcgtgccctacttgctcaccaagtttcactccggtttttccaaatagcaaatatcattcggtacatcaaaaaggtgtctcagt |
344 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2347905 |
cttgttatctttttcgcgcgtaccctacttgctcaccaagtttcactccggtttttccaaatagcaaatatcattcggtacatcaaaaaggtgtctgagt |
2348004 |
T |
 |
| Q |
345 |
tatcaatcnnnnnnncctctcttctccctctggtttgagccatcaatctattattttcttctctct |
410 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2348005 |
tatcaatctttttttcctctcttctccctctggtttgagccatcaatctattattttcttctctct |
2348070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 41 - 166
Target Start/End: Original strand, 2347701 - 2347826
Alignment:
| Q |
41 |
tttaagatgaataaaggagaaatttcgaattcaaacgtcaactctttcgtattacgatgtattatctttataaattgagctatgtttatgagaaccaggc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2347701 |
tttaagatgaataaaggagaaatttcgaattcaaacgtcaactctttcgtattacgatgtattatctttataaattgagctatgtttacgagaaccaggc |
2347800 |
T |
 |
| Q |
141 |
taaggagctgcaaatgagacagctgc |
166 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2347801 |
taaggagctgcaaatgagacagctgc |
2347826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 2347621 - 2347663
Alignment:
| Q |
1 |
acccaccaaaagtggatctttaccacatggtagtgtagaattt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2347621 |
acccaccaaaagtggatctttaccacatggtagtgtagaattt |
2347663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 312 - 401
Target Start/End: Original strand, 2348349 - 2348437
Alignment:
| Q |
312 |
atatcattcggtacatcaaaaaggtgtctcagttatcaatcnnnnnnncctctcttctccctctggtttgagccatcaatctattatttt |
401 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||| | |||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
2348349 |
atatcattcggtacaccaaaaaggcgtctgagttatcaatc-ttttttcttctcttctccctctagtttgagccatcaaagtattatttt |
2348437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University