View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20314_high_32 (Length: 251)
Name: NF20314_high_32
Description: NF20314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20314_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 40 - 232
Target Start/End: Complemental strand, 7926691 - 7926495
Alignment:
| Q |
40 |
tgtggagcccaaaaatttctgttttgattttgatgcattattacttgcatgtgtgttcacgtgggaactgtggtggcctttgcagggtggtagggagtgg |
139 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7926691 |
tgtggagcccaaaattttctgttttgattttgatgcattattacttgcatgtgtgttcacgtgggaactgtggtggcctttgcagggtggtagggagtgg |
7926592 |
T |
 |
| Q |
140 |
ttatggttacacgaatgtcatac----ttacagggtggattaggaaagtactgtctttgagatctattttttgtcatgtttttgggatcatgtccta |
232 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7926591 |
ttatggttacacgaatgtcatacttacttacagggtggattaggaaagtactgtctttgagatctattttatgtcatgtttttgggatcatgtccta |
7926495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University