View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20314_high_32 (Length: 251)

Name: NF20314_high_32
Description: NF20314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20314_high_32
NF20314_high_32
[»] chr6 (1 HSPs)
chr6 (40-232)||(7926495-7926691)


Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 40 - 232
Target Start/End: Complemental strand, 7926691 - 7926495
Alignment:
40 tgtggagcccaaaaatttctgttttgattttgatgcattattacttgcatgtgtgttcacgtgggaactgtggtggcctttgcagggtggtagggagtgg 139  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7926691 tgtggagcccaaaattttctgttttgattttgatgcattattacttgcatgtgtgttcacgtgggaactgtggtggcctttgcagggtggtagggagtgg 7926592  T
140 ttatggttacacgaatgtcatac----ttacagggtggattaggaaagtactgtctttgagatctattttttgtcatgtttttgggatcatgtccta 232  Q
    |||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
7926591 ttatggttacacgaatgtcatacttacttacagggtggattaggaaagtactgtctttgagatctattttatgtcatgtttttgggatcatgtccta 7926495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University