View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20314_high_36 (Length: 225)

Name: NF20314_high_36
Description: NF20314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20314_high_36
NF20314_high_36
[»] chr1 (1 HSPs)
chr1 (1-221)||(40460294-40460519)


Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40460519 - 40460294
Alignment:
1 cttcacttgacaacacttcattcatcttctcatcacaccaaactgcactcactcacattaatcatgcatgattagtgaaaacggttactattaataatat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
40460519 cttcacttgacaacacttcattcatcttctcatcacaccaaactgcactcactcacattaatcatgcatgattagtgaaaacggttactactaataatat 40460420  T
101 cattatcttttccttcttctttcaaagttgaaaattgaaaaacgaaacg-----aaacccttgaatttgcggtgtgataatggagttcactgaatgttac 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||    
40460419 cattatcttttccttcttctttcaaagttgaaaattgaaaaacgaaacgaaacgaaacccttgaatttgcggtgtgataatggagttcactgaatgttac 40460320  T
196 aaacaaacaggtccttcttctctctc 221  Q
    ||||||||||||||||||||| ||||    
40460319 aaacaaacaggtccttcttctttctc 40460294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University