View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20314_high_37 (Length: 212)

Name: NF20314_high_37
Description: NF20314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20314_high_37
NF20314_high_37
[»] chr1 (1 HSPs)
chr1 (118-204)||(50084728-50084814)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 118 - 204
Target Start/End: Complemental strand, 50084814 - 50084728
Alignment:
118 gaggaagatatggtagttttcaattgctctttcatttggtagtaagtatatccattgcattaaattgatggttcctctgtgctcctc 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||    
50084814 gaggaagatatggtagttttcaattgctctttcatttggtagtaagtatatccattgcattaaattgatggttcctttgtgttcctc 50084728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University