View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20314_low_29 (Length: 255)
Name: NF20314_low_29
Description: NF20314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20314_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 42821394 - 42821633
Alignment:
| Q |
12 |
cacagatgaagtagtacttgcagttgcaggagaagccacattttgctgctgctgctg---ttgatgttgct---------gttgtagggtttgaggatga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
42821394 |
cacagatgaagtagtacttgcagttgcaggagaagccacattttgctgctgctgctgctgttgatgttgctgatggtgctgttgtagggtttgaggatga |
42821493 |
T |
|
| Q |
100 |
gaacgagggtttacaaattgtgattgttgttgtgaaattacatggggttggggttggggttgagaaagctgaaaatgaccggggaattgagaaggatttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42821494 |
gaacgagggtttacaaattgtgattgttgttgtgaaattacatggggttggggttggggttgagaaagctgaaaatgaccggggaattgagaaggatttt |
42821593 |
T |
|
| Q |
200 |
gcatttgagggtgagattgagtgagaagatgaattggttg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42821594 |
gcatttgagggtgagattgagtgagaagatgaattggttg |
42821633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University