View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20314_low_34 (Length: 240)
Name: NF20314_low_34
Description: NF20314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20314_low_34 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 4878470 - 4878694
Alignment:
| Q |
17 |
acctatttatgattggaattaagtgtccaataaacagcttatgagggtatatgcaacatatgtactatttacaaaacatgtcaatctttnnnnnnnnnnn |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4878470 |
acctatttatgattggaattaagtttccaataaacagcttatgagggtatatgcaacatatgtactatttacaaaacatgtcaatctttaaaaaaaaaaa |
4878569 |
T |
|
| Q |
117 |
nnn-tcagttataaactatagttgatgtgtgttgtacaacagtttctttttcctcaaaagttttaacatcaaattcagcttagaggcaaggtttgaggag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4878570 |
aaaatcagttataaactatagttgatgtgtgttttacaacagtttctttttcctcaaaagttttaaaatcaaattcagcttagaggcaaggtttgaggat |
4878669 |
T |
|
| Q |
216 |
taggattgttgaactgctatgtctt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4878670 |
taggattgttgaactgctatgtctt |
4878694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University