View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20314_low_38 (Length: 212)
Name: NF20314_low_38
Description: NF20314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20314_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 118 - 204
Target Start/End: Complemental strand, 50084814 - 50084728
Alignment:
| Q |
118 |
gaggaagatatggtagttttcaattgctctttcatttggtagtaagtatatccattgcattaaattgatggttcctctgtgctcctc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
50084814 |
gaggaagatatggtagttttcaattgctctttcatttggtagtaagtatatccattgcattaaattgatggttcctttgtgttcctc |
50084728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University