View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20314_low_9 (Length: 445)
Name: NF20314_low_9
Description: NF20314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20314_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 1 - 431
Target Start/End: Complemental strand, 7430744 - 7430314
Alignment:
| Q |
1 |
ataatactctgttatatcattcagtccagttcttcctcaaatctcaaccatcacattcatatttcatccaccaccacgcgctactcaattctcacgcgcc |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7430744 |
ataatattctgttatatcattcagtccagttcttcctcaaatctcaaccatcacattcacatttcctccaccaccacgcgctactcaattctcacgcgcc |
7430645 |
T |
|
| Q |
101 |
tccgatcaaaaccaatgcgccaccactgatgcgcatggagataacaccaacaaccttcgcatcccacagttactccgaccttccctccgccgcatccatg |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430644 |
tccgattaaaaccaatgcgccaccactgatgcgcatggagataacaccaacaaccttcgcatcccacagttactccgaccttccctccgccgcatccatg |
7430545 |
T |
|
| Q |
201 |
ccgactcgtcctatcagagttatccctatgcaacatccaaaccttacgtctccatcttcttcgaattcgttacctccgaatgtcgcgattacgcagttcg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430544 |
ccgactcgtcctatcagagttatccctatgcaacatccaaaccttacgtctccatcttcttcgaattcgttacctccgaatgtcgcgattacgcagttcg |
7430445 |
T |
|
| Q |
301 |
cgtcgaagcttcgaggaatgacgtggcttgaatggattgagttcttgattccttgttatcgttggattcggatatataaatggcgtgagtatcttcaggt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430444 |
cgtcgaagcttcgaggaatgacgtggcttgaatggattgagttcttgattccttgttatcgttggattcggatatataaatggcgtgagtatcttcaggt |
7430345 |
T |
|
| Q |
401 |
tgatcttatggctggaatcaccgttggtgtt |
431 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7430344 |
tgatcttatggctggaatcaccgttggtgtt |
7430314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University